br DNA fingerprinting analysis The target

DNA fingerprinting analysis The target regions of genomic DNA were amplified by Polymerase chain reaction (PCR). The PCR was carried out using a Thermocycler type PTC100 (MJ Research Inc) for 35cycles and each cycle contained 96°C for 30s, 56°C for 30s and 72°C for 30s. The following primer sequences (5′–3′) were used for DNA fingerprinting: D7S796 forward TTTTGGTATTGGCCATCCTA, reverse GAAAGGAACAGAGAGACAGGG; D10S1214 forward ATTGCCCCAAAACTTTTTTG, reverse TTGAAGACCAGTCTGGGAAG, D17S1290 forward GCAACAGAGCAAGACTGTC, reverse GGAAACAGTTAAATGGCCAA and D21S2055 forward AACAGAACCAATAGGCTATCTATC and reverse TACAGTAAATCACTTGGTAGGAGA.
Embryoid body formation For in vitro differentiation, CV-iPSCs were seeded on ultra-low attachment dishes (Corning) and cultured in DMEM (Gibco/Life Technologies). After 7days, the floating EBs were transferred into separate wells within a 12-well plate, previously coated with Gelatin (0.8ml/well), thus allowing attachment. After subsequent cultivation in DMEM medium for additional 14days, the adherent growing random differentiated cells were fixed with paraformaldehyde fixing buffer and analyzed by immunocytochemistry for expression of lineage specific markers.
Immunofluorescence-based detection of proteins Adherent growing cells were briefly washed twice by rinsing the wells with 1X PBS buffer and then fixed with paraformaldehyde fixing buffer for 15min at room temperature. After removal of PFA, the wells were rinsed twice with PBS. Subsequently, the cells were permeabilized with 0.1% Triton X-100 in PBS for 1h at room temperature. Thereafter, primary Wnt-C59 were diluted at 1:200 in blocking buffer and either incubated for 2h at room temperature or overnight at 4°C, followed by 3×10min washing with PBS. Primary antibodies were used as follows: OCT4 (Santa Cruz, #sc-5279), NANOG (R&D, #AF1997), SOX2 (Santa Cruz, #sc-17320) and LIN28 (Proteintech, #11724-1-AP). Antibodies against SSEA-3, SSEA4, TRA-1-60 and TRA-1-81 of the hESC characterization kit (Merck Millipore, #SCR004) were used. In addition, antibodies were used against Smooth-Muscle-Actin (SMA) (Dako, #M0851), α-Fetoprotein (AFP) (Sigma, #WH0000174M1) and β-TubulinIII (TUJ1) (Sigma, #T8660). Then, appropriate fluorescence-labeled secondary antibodies were diluted at 1:300 in blocking buffer and applied under the same conditions while protected from light. After washing 3×10min with PBS, the nuclei were counterstained with DAPI (Invitrogen, #H3570) staining solution for 3min at room temperature. After removal of DAPI, the wells were rinsed twice with PBS. The fluorescence-stained cells were then analyzed.
Teratoma formation For in vivo differentiation, iPSC colonies were grown on feeder layers of mitotically inactivated Mouse embryonic fibroblasts (MEFs) and dissociated into single cells by trypsinization. After repeated washing/centrifugation steps with DPBS (3×), cell pellets consisting of approximately 1–2×106 cells were resuspended in 50μl DPBS and instantly mixed at a ratio of 1:2 with Matrigel. The 100μl mixtures were at once subcutaneously injected into the right latus of the abdomen of immunodeficient NOD.Cg-Prkdcscid Il2rgtm1Wjl/Szj mice, commonly known as NOD scid gamma (NSG) mice. Once the developed teratomas had reached a critical volume of >1cm3 in relation to the average body weight of the mice (≈22g), the mice were sacrificed. The teratomas were collected and processed using standard procedures for paraffin embedding, then hematoxylin and eosin staining. Histological analysis was performed by a pathologist.
Karyotype analysis Cytogenetic GTG-banding chromosome analysis of feeder-free iPSC cells was performed by the human geneticist Prof. Dr. Gundula Thiel (Praxis für Humangenetik, Friedrichstraße 147, 10117 Berlin; http://www.humangenetik-berlin.de). Of each sample, 18 metaphases were counted and 10 karyograms were analyzed.